[python] Forum Topics

I am developing one multithreaded application. I am successfully running my functions on their own thread(created 24 threads already). I am attempting to give its own thread to one function that is rendering a new window in it. I am receiving an error here, due to the single thread architecture. …

hii everybody, I have a weird problem with a program for solving sudoku puzzles. I am representing the puzzle as a list of lists of lists containing all the possibillities for a single square and my problem is that when I try to remove a single appearance of a number …

Our organization has hundreds of project numbers. I would like to create a program that will let me store the numbers along with keywords in a database, and then have the option for predictive searching. By predictive searching I mean something similar to how when you start typing something in …

Hello everyone, my file1.txt have sequences as given below: >1|62798264|[COLOR="Red"]rs8174605[/COLOR]|T/C||dbSNP|T/C AAGAGGAGAAAGCAAAGTTGCAAAAGGTGAAAGAGAAAGAAGAGCTAGAGAAGGGCAGGA AGGAGCAGAGTAAGCAGAGGGAGCCTCAGAAGAGACCGGA_GAGGAGGTGTTGGTGCTCA >1|100159271|ENSRNOSNP145|T/A||ENSEMBL:celera|T/A TCTTATAATTAGTCATTGTGATAACTGCTACAAACAAAGTCACAGGATCTTGTGAGAGAA >1|19033646|[COLOR="Red"]rs8173848[/COLOR]|C/T||dbSNP|C/T TTGCAAAAAAAAAAAAAAAAAAAAAAAGCCAGAATCCAGCATAAGTCAAGGAAATCCACT >1|149643853|[COLOR="Red"]rs8173465[/COLOR]|G/T||dbSNP|G/T AACAGAGACAGCTGTGATGTACCCCATGAGCTGGAAAGAGCAGCCCAGCGGTGTCCCAGC >1|101456015|ENSRNOSNP1318|G/C||ENSEMBL:celera|G/C AACTCTTAGAAGTTAGAACCTGGGGTGGAGAGATGGCTTGGTGGTTGAGAGCATTGACTG I want result file which do not have sequences with "rs"number e.g rs8177678, these are colored red in each sequence. so my output file should have 2 sequences: >1|100159271|ENSRNOSNP145|T/A||ENSEMBL:celera|T/A TCTTATAATTAGTCATTGTGATAACTGCTACAAACAAAGTCACAGGATCTTGTGAGAGAA …

hello everyone, my file has many long lines witth 12 ccolumns like: gnl|dbS|13484118 gi|62750812 100 16 .......around 12 columns gnl|dbS|13484888 gi|62750812 95 20 ....... gnl|dbS|22484118 gi|62750812 92 20 .......... I want to grab the lines where values of column 3 lies between 90 - 99.9 in the file and store …

Can this be done in Python?.. which is done in perl. [CODE=perl]open(TEST,">test.txt"); *STDOUT = *TEST; print "print somting..."; print "print somting..."; *STDOUT = *FHSAVE;[/CODE]All the print statement between the lines "*STDOUT = *FHSAVE;" will be written in to test.txt. Is there any way to do this in python. Thanks.

Hi, I have my own widgets ( simple one) and want to put them in one file and call them from second file. This is like easygui but with pyqt4. My problem - when I call my widget from second file nothing happens. This is file with widgets (example). [code …

Ok so I was working on file handling, nothing special just making new (.txt) files and putting some text in it. That works fine the problem is that when I try to read the file from within python nothing comes up and when I try to open the file once …

Been trying to make a substitution cipher decrypter, but it isn't working especially good. so I thought I might could get some help with it. [code=c++] #include <iostream> #include <time.h> #include <windows.h> #include <iomanip.h> #include <string.h> using namespace std; int main() { bool EndThisShit(false); do { string input; cin >> …

due to someone elses post about a keylogger, i wanted to use the program: [code=python] # get the character of a key pressed (no return key needed) # works only in the command window and with Windows OS # msvcrt.dll is the MS C library containing most standard C functions …

Hello I've writing a application that is consists of a wxpython notebook and each page is a form to fill in, parcel query form, holiday form, product query form etc. Then there would be a button on each page to press that would create a simple text file that'd be …

I am sorry if it is simple or repetitive but I have problem with this. I make a play : I have python 2.6 or 3.0 a program in my c partition its name is test.py I want to compile it and it have to works in linux and windows. …

Sorry.. I am new to this forum. I tried to find solution from older threads but couldn't. Here I am starting a new thread. My doubt is that suppose i want to do one looping process to assign values, how I have to do. For example: Having one list like …

Hi All, I need one more help in string manipulation.. I am having a line as follows: [QUOTE] variable (x1|y1|z1)(x2||z2)(x3|y3|z3)[/QUOTE] From this I need to take values and store in lists like [QUOTE] xList = [x1, x2, x3] yList = [y1, 0, y3] zList = [z1, z2, z3][/QUOTE] Please help …

I have the following code working perfectly for basic authentication with http. I'm going to be changing the site, however, to https. Can anyone point me in the right direction here? [CODE] import urllib2 from matplotlib.dates import strpdate2num from matplotlib.mlab import load from pylab import figure, show import urllib theurl …

Hi, could anyone help me updating my pictures and texts. The first picture and text is okay but then the next just gets added in the same textarea instead of "refreshing the page" and adding the next "page" with a pic and text. I also get this error message. screen.delete(0.0, …

Hi attempting to make an address book program but hit a snag- I have: A class to give various attributes(phone numbers etc)to an instance which then puts it all into a doc string which can be added to a dictionary- but I want a function that will ask the user …

When I run this code: [code=python] import wx ID_FILE_QUIT = 101 class MainFrame(wx.Frame): def __init__(self, title): wx.Frame.__init__(self, None, wx.ID_ANY, title=title) self.menuBar = wx.MenuBar() self.fileMenu = wx.Menu() self.fileMenu.Append(1, '&Quit\tCtrl+Q') self.Bind(wx.EVT_MENU, self.Close(), id=ID_FILE_QUIT) self.menuBar.Append(self.fileMenu, '&File') self.SetMenuBar(self.menuBar) self.Show() app = wx.App() frame = MainFrame('Ya Mum') app.MainLoop() [/code] I get some error about expecting …

Hello, I have a certain way i want to do something but im not sure where to start, or if python can even do it. what i want is a way to display the current action during a large data conversion program.... I want it to look like an GUI …

Hello. I hope not to annoy you with such a question. I'd like to read cell data from specific columns within a spreadsheet. I'm trying to read data within the following format (from the .xls file I'm analyzing). [code] Wavelength (nm),Absorbance (AU),Std.Dev. 190,-0.333324432373047,0.187723662173536 191,-0.184257030487061,0.169325912513228 192,0.0989446640014648,0.243154257457939 193,-0.196856021881104,0.322099862671817 194,0.0530929565429688,0.250335468281439 195,0.146337985992432,0.301110817821903 196,0.0579915046691895,0.359937145256163 197,-0.309549331665039,0.293385120791022 …

Right, so I looked at some python tutorials about interfacing with internet, but every time a use a code such as: [code] import urllib pagetext = urllib.urlopen("http://www.python.org.html").read() print pagetext [/code] It just comes up with a load of error messages. how can i sort this

im having a head ache how to make a java sample output like this: sample output: Please Enter 2 values:(number must range from 1 to 9)else display error message value 1: 3 value 2: 8 Fibonacci numbers are: 11 19 30 49 79 128 207 335 542 Even numbers are: …

I'm a programmer in C# ASP.NET. Side languages include entry level Python, C++. Hope I can contribute.:)

You might have seen my lurking around on #Daniweb while I am at work. I thought I'd give you an idea who was behind that tongue-twisted nick. I go by "J", for reasons that are mostly historical. I suppose you could say at this point that I'm growing back into …

Hi, I have this code: list = ['12 angry men', 'Rash &# xf4;mon'] [CODE]def func(list): ... for e in list: ... e = re.sub(' ?&# x([0-9a-f]*);',r'\x\1',e) ... print type(e) ... e = unicode(e,'iso-8859-1') ... print type(e) ... print e[/CODE] I get this output: [CODE] 12 angry men Rash\xf4mon[/CODE] whereas I …

i've made a little animation using python and the pygame module, I'm just wondering if it's possible to turn that into a screensaver? is there a format i have to save it to? If anyone knows i would be grateful for the solution thanks, a1eio

I'm brand new to python (and programming) and trying to write a script that will download a .csv from the Internet and then allow me to plot data from the .csv. I already have the plot working, and I can grab the file locally, but I can't figure out how …

Hi all, Can anybody tell me how to calculate the order of a recursive function. Lets take factorial function. Without using recursion [COLOR=blue]int x =1;[/COLOR] [COLOR=blue]for(int i = 1;i<=n;i++)[/COLOR] [COLOR=blue] x = x*i;[/COLOR] In this case the order will the O(n) in terms of time and in terms of space …

Dear friends, I have this code which attempts to get the last modified date of an http resource: [CODE]request = urllib2.Request('http://www.imdb.com') >>> opener = urllib2.build_opener() >>> request.headers {} >>> first = opener.open(request) >>> first.headers.dict {'transfer-encoding': 'chunked', 'set-cookie': 'session-id=209.251.138.146.1246519635845007; path=/; domain=.imdb.com, uu=bN4RO5T1YWqLBgRAupwcdgCRSyzj0j26pvJ+qYPCXqmT117Zs9L+/LfGO4zGx50bwJFtjNPSXuqj8g4pgDJ+meCRbaoGcS2aoNZb7PiBbbqjkm66I/I+qSAyfpnj8l7qA/I+qTAyfpngkW2KBnEtmqDXe20AkW26oLFtuqC3KyrjwW26o5IOuZOyLtnAgc0ZsLFtuqCRbergwR2Ko=;expires=Thu, 30 Dec 2037 00:00:00 GMT;path=/;domain=.imdb.com, cs=xOA2Pyx3xsSbt7wMU8ZOhAbGfbqgkW2NmIHl2qPyXuoj8j6pMDJ+meCRbYoGES2aoJFb/feFHbqjsg7/p9HNySCRWyxAGW26oKdbraCRbbqgsW26oJFt+uDBHYqg==;expires=Fri, 03 Jul 2009 …

How to acheive this in Python? [QUOTE]Converting the string "HelloPythonWorld" to "HELLO_PYTHON_WORLD"[/QUOTE]

Hi, This is the existing code: [CODE]for c in chartNames: chartUrl = baseChartUrl+c hd = extractChart(chartUrl) writeChart(hd,c) for key in hd: if key in chart: chart[key].append(c) else: chart[key] = [c] [/CODE] when i wanted to insert a line before [CODE]chartUrl = baseChartUrl+c[/CODE] by putting the cursor to the end of …

Hi everyone it's been almost a year since I gave up programing in python so I have forgotten a lot of things, so just bare with me. Ok so I was playing around with python and ended up with this little program. [code=python] def test(): number = input("Number: ") scale …

Greetings. First of all, I hope I got the correct forum. ;) My final semester is approaching soon :sad: and I've got to do a final year project by then. I'd like to propose my own title to my supervisor but I do not have any ideas as yet. Well, …

I am having a text file contaning the following: "int Function1 (int arg1, "0|1", char * arg2); int Function2 (int arg1, " ", char * prt1); ..." I need to open this file, split the each word and store it as global variable. I did this in Perl but now …

Hi, i wrote the socket script in python, Here both server and client running in under same machine. operating system is ubuntu 8.10 desktop version. [B]tcp server[/B] [CODE] 1 #!/usr/bin/env python 2 3 import socket 4 import sys 5 6 server_socket = socket.socket(socket.AF_INET,socket.SOCK_STREAM) 7 server_socket.bind(("", 5000)) 8 server_socket.listen(5) 9 while …

I'm using poisson's process for probability. This is the equation I'm using : P(x)= ((lamda^x)*e^(-lamba))/x! it's the factorial part I'm not getting right though. I can get the first 3 probabilities right (0,1,2) but everything after that starts to be off by half and so on. Look I know the …

Hello, I am new to Python. I am trying to start writing some simple programs in it. Which IDE would you suggest? I am currently using NeatBeans for my Java programs but i don't think i can use it for Python P.S. I am using Mac OS X 10.5.7 Thank …

I'm working on learning on programming with Pygame by following a tutorial linked from the Pygame site. I seem to have stuck myself in a hole, however, because I can't seem to set keys to do different things within the program. I'm trying to first close the program by pressing …

Hey could someone suggest a free application for screen scraping ? the only ones i can find seem to be for big companies and for large-scale projects when i just need it to update press reviews for my blog. i use firefox but could switch based on what you guys …

If I do something like this: [code] print "%08d" % 2 [/code] It will print '00000002'. However, I want to change the "8" to a "3" at runtime (to get '002' instead). I tried this: [code] MyLength = 3 print "%0" + str(MyLength) + "d" % 2 [/code] but I …

Hello, I am trying to write a GUI front (with tcl/tk) for a python module. Unfortunately the module takes parameters and I don't know how to call a python module with parameters without going into interactive mode (I'm running Debian) I can get tcl to run a test module with …

Hey guys, Lets say I had two different files, each with a column of data. So: [CODE](File 1) 1 2 3[/CODE] And [CODE](File 2) Friend Foe Fighter[/CODE] In the end, I want to unify these into one large file: [CODE] 1 Friend 2 Foe 3 Fighter[/CODE] Each file has an …

Hi all, I'm looking for some direction in how to approach this problem. $arr = array(1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20); I need to create a second array using the values in the first array in …

Hi All, In my python script i use to run some oracle queries for this i require a library to connect to oracle which is [B]cx_Oracle[/B]. When we were using 9i(oracle).. my script was running fine.. and now when we migrated to 10 G its giving problem... Few lines of …

Hi, I posted some Python code on my blog at blogspot [URL]http://pyarticles.blogspot.com/[/URL] . However, it not display my code correctly. How can I do to solve this problem ? Thanks :) Eiwot

Hi, I am new to socket programming, I have a generated data for every minute in client side and i want to send this data to server for every minute using python script. Client laptop having Airtel GPRS connection(in moving vehicle) and server desktop at my home. Both client and …

Hi All, I am using the following code to write data into an excel sheet: [CODE]# Open the Output Spreadsheet objExcel = win32com.client.Dispatch("Excel.Application") # Creating object to write to Spreadsheet self.xlApp =Dispatch("Excel.Application") # Creating Workbook self.Wkbk = self.xlApp.Workbooks.Add() # Get sheet count intShtCnt=self.Wkbk.Worksheets.Count # Creating worksheets wsObjReport = self.Wkbk.Worksheets.Add() # …

Hi friends, I have developed a program with reportlabs module to generate a PDF file on macos x. The pdf file is generated successfully But, i cant open the pdf file automatically i mean manually i click on that file then it will be opened. Also i used this syntax …

Hi, I'm Arin. Over the past few days I've started learning Python as my first programming language, and am also messing around with Ruby (when Python gets frustrating). I found this site from doing google searches for little bits of python code, and decided to register, as it's apparently a …

I need help please. this cgi program works fine only if the user puts in more than 66 chars..i chopped the lines into 66 chars each so they would fit in the textarea the problem is that record comments() works perfectly for writing multiple lines and the \n char in …